Sequence retrieval

Genome: Streptococcus suis SC84
Start position: 999818
End position: 999841
Length: 24

DNA sequence
>NC_012924, from 999818 to 999841 (24 bp); Streptococcus suis SC84 ATATTCAGATTCATATTGATAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 999468-1001303	Sequence	SSUSC84_0926 - hypothetical protein (Protein is coded in complementary strand; from 1001303 to 999468)