Sequence retrieval

Genome: Streptococcus suis SC84
Start position: 960692
End position: 960736
Length: 45

DNA sequence
>NC_012924, from 960692 to 960736 (45 bp); Streptococcus suis SC84 TCACTCCCTTCAGTTTCACTATATTCAGTTTCACTTCCTTCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 960374-961192	Sequence	SSUSC84_0889 - replication initiator protein A protein (Protein is coded in complementary strand; from 961192 to 960374)