Sequence retrieval

Genome: Streptococcus suis SC84
Start position: 1776549
End position: 1776572
Length: 24

DNA sequence
>NC_012924, from 1776549 to 1776572 (24 bp); Streptococcus suis SC84 TCTTCCTCTTGCTCTACCTCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1776234-1776956	Sequence	SSUSC84_1697 mecA adaptor protein (Protein is coded in complementary strand; from 1776956 to 1776234)