Sequence retrieval

Genome: Streptococcus suis SC84
Start position: 1242683
End position: 1242706
Length: 24

DNA sequence
>NC_012924, from 1242683 to 1242706 (24 bp); Streptococcus suis SC84 ATACCAATCCCAATAGCAAGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1242371-1243195	Sequence	SSUSC84_1167 - ZIP zinc transporter family protein (Protein is coded in complementary strand; from 1243195 to 1242371)