Sequence retrieval

Genome: Thermococcus sibiricus MM 739
Start position: 234844
End position: 234873
Length: 30

DNA sequence
>NC_012883, from 234844 to 234873 (30 bp); Thermococcus sibiricus MM 739 AGAGTTCTATAAACTTCTATAAAGTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 234361-235332	Sequence	TSIB_0241 - hypothetical protein (Protein is coded in complementary strand; from 235332 to 234361)