Sequence retrieval

Genome: Thermococcus sibiricus MM 739
Start position: 217861
End position: 217890
Length: 30

DNA sequence
>NC_012883, from 217861 to 217890 (30 bp); Thermococcus sibiricus MM 739 GTTTCAGTTTTAGTTTCGGTTACAGTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 217771-218913	Sequence	TSIB_0223 - amylopullulanase (Protein is coded in complementary strand; from 218913 to 217771)