Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 254583
End position: 254618
Length: 36

DNA sequence
>NC_012815, from 254583 to 254618 (36 bp); Bifidobacterium animalis subsp. lactis DSM 10140 ACTGTTGTTGCTGCCGTTGTTGCTGCCGTTGTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 254476-256884	Sequence	Balat_0218 - penicillin-binding protein (Protein is coded in complementary strand; from 256884 to 254476)