Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1928036
End position: 1928071
Length: 36

DNA sequence
>NC_012815, from 1928036 to 1928071 (36 bp); Bifidobacterium animalis subsp. lactis DSM 10140 AGCATCCCCCCGAGCATGCCGCCGAGCTTCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1926246-1930268	Sequence	Balat_1622 - hypothetical protein