Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1328942
End position: 1328977
Length: 36

DNA sequence
>NC_012815, from 1328942 to 1328977 (36 bp); Bifidobacterium animalis subsp. lactis DSM 10140 CGATGTCATCGTCGGCGTCATCGTCGGCGTCATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1327816-1330650	Sequence	Balat_1148 - putative ABC transporter integral membrane protein