Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1323885
End position: 1323917
Length: 33

DNA sequence
>NC_012815, from 1323885 to 1323917 (33 bp); Bifidobacterium animalis subsp. lactis DSM 10140 GCATCACTTGGACATCACCTGGACATCACTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1323911-1325551	Sequence	Balat_1145 - oligopeptide ABC transporter periplasmic protein (Protein is coded in complementary strand; from 1325551 to 1323911)