Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1778701
End position: 1778730
Length: 30

DNA sequence
>NC_012815, from 1778701 to 1778730 (30 bp); Bifidobacterium animalis subsp. lactis DSM 10140 GCGGCGGTGGCGGAGGCGGCGCCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1778083-1780407	Sequence	Balat_1514 - Phosphoglycerol transferase