Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1738661
End position: 1738690
Length: 30

DNA sequence
>NC_012815, from 1738661 to 1738690 (30 bp); Bifidobacterium animalis subsp. lactis DSM 10140 CAGTGCAGATCAGCGCAGCTCAGTGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1738681-1739343	Sequence	Balat_1479 - hypothetical protein (Protein is coded in complementary strand; from 1739343 to 1738681)