Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 509387
End position: 509413
Length: 27

DNA sequence
>NC_012815, from 509387 to 509413 (27 bp); Bifidobacterium animalis subsp. lactis DSM 10140 GATTAGGTGGATTGGGTGGATTGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 509390-510850	Sequence	Balat_0430 - histidine kinase sensor of two component system (Protein is coded in complementary strand; from 510850 to 509390)