Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 496770
End position: 496796
Length: 27

DNA sequence
>NC_012815, from 496770 to 496796 (27 bp); Bifidobacterium animalis subsp. lactis DSM 10140 GGTCGATGTGGTCGACGTCGTCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 496319-497020	Sequence	Balat_0420 - ribose-5-phosphate isomerase A (Protein is coded in complementary strand; from 497020 to 496319)