Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1925649
End position: 1925675
Length: 27

DNA sequence
>NC_012815, from 1925649 to 1925675 (27 bp); Bifidobacterium animalis subsp. lactis DSM 10140 GATGCCAACGATGCCGACGATGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1924000-1926249	Sequence	Balat_1621 - hypothetical protein