Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1673443
End position: 1673469
Length: 27

DNA sequence
>NC_012815, from 1673443 to 1673469 (27 bp); Bifidobacterium animalis subsp. lactis DSM 10140 TGGATTCAGTGGATTCATTGGATTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1673334-1674683	Sequence	Balat_1425 - hypothetical protein (Protein is coded in complementary strand; from 1674683 to 1673334)