Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1553520
End position: 1553546
Length: 27

DNA sequence
>NC_012815, from 1553520 to 1553546 (27 bp); Bifidobacterium animalis subsp. lactis DSM 10140 TCGTCGGCATCGTTGGCATCGGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1549626-1554179	Sequence	Balat_1334 - hypothetical protein (Protein is coded in complementary strand; from 1554179 to 1549626)