Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis DSM 10140
Start position: 1092418
End position: 1092441
Length: 24

DNA sequence
>NC_012815, from 1092418 to 1092441 (24 bp); Bifidobacterium animalis subsp. lactis DSM 10140 ACCGCCACCGTCACCGACACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1092178-1092798	Sequence	Balat_0955 - hypothetical protein (Protein is coded in complementary strand; from 1092798 to 1092178)