Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 564133
End position: 564156
Length: 24

DNA sequence
>NC_012785, from 564133 to 564156 (24 bp); Kosmotoga olearia TBF 19.5.1 GCACAAAAGCAGAAAAGCAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 560338-564183	Sequence	Kole_0513 - hypothetical protein (Protein is coded in complementary strand; from 564183 to 560338)