Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 1959511
End position: 1959534
Length: 24

DNA sequence
>NC_012785, from 1959511 to 1959534 (24 bp); Kosmotoga olearia TBF 19.5.1 TCTCGGTCTCTCGGTTTCTCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1959451-1959558	Sequence	Kole_1831 - hypothetical protein (Protein is coded in complementary strand; from 1959558 to 1959451)