Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 1341562
End position: 1341585
Length: 24

DNA sequence
>NC_012785, from 1341562 to 1341585 (24 bp); Kosmotoga olearia TBF 19.5.1 TTCTCGGACTCTCGGATTCTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1341348-1341656	Sequence	Kole_1263 - hypothetical protein (Protein is coded in complementary strand; from 1341656 to 1341348)