Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 717914
End position: 717940
Length: 27

DNA sequence
>NC_012785, from 717914 to 717940 (27 bp); Kosmotoga olearia TBF 19.5.1 GAATCATAAGAATCACAAGAACCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 716846-718645	Sequence	Kole_0674 - hypothetical protein (Protein is coded in complementary strand; from 718645 to 716846)