Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 665357
End position: 665380
Length: 24

DNA sequence
>NC_012785, from 665357 to 665380 (24 bp); Kosmotoga olearia TBF 19.5.1 ACTTCCACTTTCCCTTCCACCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 664382-665365	Sequence	Kole_0619 - nitroreductase (Protein is coded in complementary strand; from 665365 to 664382)