Sequence retrieval

Genome: Kosmotoga olearia TBF 19.5.1
Start position: 1405274
End position: 1405297
Length: 24

DNA sequence
>NC_012785, from 1405274 to 1405297 (24 bp); Kosmotoga olearia TBF 19.5.1 CGAGAATCCGAGAGTCCGAGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1404949-1405632	Sequence	Kole_1326 - hypothetical protein (Protein is coded in complementary strand; from 1405632 to 1404949)