Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 395564
End position: 395608
Length: 45

DNA sequence
>NC_012673, from 395564 to 395608 (45 bp); Exiguobacterium sp. AT1b CGGTTCTTCTTCAGCCGGCTCCTCGTCAGCCGGTTCTTCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 395217-396089	Sequence	EAT1b_0432 - XRE family transcriptional regulator (Protein is coded in complementary strand; from 396089 to 395217)