Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 800922
End position: 800949
Length: 28

DNA sequence
>NC_012673, from 800922 to 800949 (28 bp); Exiguobacterium sp. AT1b GATAATCGATATTCGCTAATCGATTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 800786-801745	Sequence	EAT1b_0848 - HNH endonuclease (Protein is coded in complementary strand; from 801745 to 800786)