Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 927836
End position: 927860
Length: 25

DNA sequence
>NC_012673, from 927836 to 927860 (25 bp); Exiguobacterium sp. AT1b ATTTCATTACGTTTCGTTTCATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 927785-929731	Sequence	EAT1b_0988 - hypothetical protein (Protein is coded in complementary strand; from 929731 to 927785)