Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 1900883
End position: 1900907
Length: 25

DNA sequence
>NC_012673, from 1900883 to 1900907 (25 bp); Exiguobacterium sp. AT1b TTTTTATTTTTTTTCGTTTTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1900887-1901666	Sequence	EAT1b_1940 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 1901666 to 1900887)