Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 568096
End position: 568119
Length: 24

DNA sequence
>NC_012673, from 568096 to 568119 (24 bp); Exiguobacterium sp. AT1b TCTGCTTCTGCGTTTGCTTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 567754-569580	Sequence	EAT1b_0616 - chaperone protein DnaK (Protein is coded in complementary strand; from 569580 to 567754)