Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 2887344
End position: 2887367
Length: 24

DNA sequence
>NC_012673, from 2887344 to 2887367 (24 bp); Exiguobacterium sp. AT1b AAGCGCAACCGCAAGCGGAAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2886633-2887763	Sequence	EAT1b_2926 - CheC, inhibitor of MCP methylation / FliN fusion protein