Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 2435184
End position: 2435207
Length: 24

DNA sequence
>NC_012673, from 2435184 to 2435207 (24 bp); Exiguobacterium sp. AT1b ATCCTCATCATCGTCCTCATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2434939-2435325	Sequence	EAT1b_2479 - hypothetical protein (Protein is coded in complementary strand; from 2435325 to 2434939)