Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 1702821
End position: 1702844
Length: 24

DNA sequence
>NC_012673, from 1702821 to 1702844 (24 bp); Exiguobacterium sp. AT1b AAAAGAAAAATAAAAAGAAAAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1701993-1702853	Sequence	EAT1b_1733 - 60 kDa inner membrane insertion protein