Sequence retrieval

Genome: Exiguobacterium sp. AT1b
Start position: 1310108
End position: 1310131
Length: 24

DNA sequence
>NC_012673, from 1310108 to 1310131 (24 bp); Exiguobacterium sp. AT1b GCCATCGTCATCCCCATCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1309646-1310869	Sequence	EAT1b_1340 - sodium/hydrogen exchanger (Protein is coded in complementary strand; from 1310869 to 1309646)