Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 986269
End position: 986292
Length: 24

DNA sequence
>NC_012669, from 986269 to 986292 (24 bp); Beutenbergia cavernae DSM 12333 GCGGCGGCGACGGCGTCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 985606-986826	Sequence	Bcav_0886 - ornithine aminotransferase (Protein is coded in complementary strand; from 986826 to 985606)