Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 906092
End position: 906115
Length: 24

DNA sequence
>NC_012669, from 906092 to 906115 (24 bp); Beutenbergia cavernae DSM 12333 GGCTGACGGGCTGACAGGCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 903939-906098	Sequence	Bcav_0810 - peptidase S9 prolyl oligopeptidase active site domain-containing protein