Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 827445
End position: 827468
Length: 24

DNA sequence
>NC_012669, from 827445 to 827468 (24 bp); Beutenbergia cavernae DSM 12333 AGGACGACGACGAGGACGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 826947-827591	Sequence	Bcav_0747 - hypothetical protein (Protein is coded in complementary strand; from 827591 to 826947)