Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 741871
End position: 741906
Length: 36

DNA sequence
>NC_012669, from 741871 to 741906 (36 bp); Beutenbergia cavernae DSM 12333 CGGACGAGGCGGACGACGCGGACGAGTCGGACCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 740917-741921	Sequence	Bcav_0664 - DNA polymerase LigD, polymerase domain-containing protein