Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 705207
End position: 705242
Length: 36

DNA sequence
>NC_012669, from 705207 to 705242 (36 bp); Beutenbergia cavernae DSM 12333 CTCGCCCGTCGGTTCGCCGGTCGGCTCGTCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 704230-705525	Sequence	Bcav_0632 - hypothetical protein (Protein is coded in complementary strand; from 705525 to 704230)