Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 662092
End position: 662115
Length: 24

DNA sequence
>NC_012669, from 662092 to 662115 (24 bp); Beutenbergia cavernae DSM 12333 CGCTCGTGCTCGGGCTCGTGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 661399-662679	Sequence	Bcav_0597 - binding-protein-dependent transport system inner membrane protein