Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 658509
End position: 658533
Length: 25

DNA sequence
>NC_012669, from 658509 to 658533 (25 bp); Beutenbergia cavernae DSM 12333 GGCAGCGCAGGGCTGGGCGGGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 658462-660399	Sequence	Bcav_0595 - family 5 extracellular solute-binding protein