Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 634558
End position: 634593
Length: 36

DNA sequence
>NC_012669, from 634558 to 634593 (36 bp); Beutenbergia cavernae DSM 12333 CGCCGCCGCCGCCGGCGTCGCCGCCGCCCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 633255-634667	Sequence	Bcav_0572 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 634667 to 633255)