Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 578621
End position: 578656
Length: 36

DNA sequence
>NC_012669, from 578621 to 578656 (36 bp); Beutenbergia cavernae DSM 12333 GCGACGAGCCGAGCGCCGAGTCGAGCGCCGAGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 577808-579640	Sequence	Bcav_0522 - peptidase S9 prolyl oligopeptidase active site domain-containing protein