Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 538750
End position: 538773
Length: 24

DNA sequence
>NC_012669, from 538750 to 538773 (24 bp); Beutenbergia cavernae DSM 12333 CGGCGACGGCGACGGGGACGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 538665-539375	Sequence	Bcav_0483 - hypothetical protein (Protein is coded in complementary strand; from 539375 to 538665)