Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 515101
End position: 515127
Length: 27

DNA sequence
>NC_012669, from 515101 to 515127 (27 bp); Beutenbergia cavernae DSM 12333 CGGCGAGCGCGGCGAGCGCGACGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 513831-515657	Sequence	Bcav_0462 - hypothetical protein (Protein is coded in complementary strand; from 515657 to 513831)