Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 490487
End position: 490540
Length: 54

DNA sequence
>NC_012669, from 490487 to 490540 (54 bp); Beutenbergia cavernae DSM 12333 CAGGCTGGGCGGGAGGTGCGGGCGGGGCGGGGGGTGCGGGCTGGGCTGGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 490447-491364	Sequence	Bcav_0442 - ABC transporter (Protein is coded in complementary strand; from 491364 to 490447)