Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4660954
End position: 4660988
Length: 35

DNA sequence
>NC_012669, from 4660954 to 4660988 (35 bp); Beutenbergia cavernae DSM 12333 AGCACCGCGCACCGAGCACCGAGCACCGAGCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4660493-4661299	Sequence	Bcav_4219 - hypothetical protein (Protein is coded in complementary strand; from 4661299 to 4660493)