Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4608610
End position: 4608645
Length: 36

DNA sequence
>NC_012669, from 4608610 to 4608645 (36 bp); Beutenbergia cavernae DSM 12333 GGATCCTCGGTGGGATCTTCCGTGGGTTCCTCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4608379-4610889	Sequence	Bcav_4182 - glycosyl transferase family protein (Protein is coded in complementary strand; from 4610889 to 4608379)