Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4559791
End position: 4559814
Length: 24

DNA sequence
>NC_012669, from 4559791 to 4559814 (24 bp); Beutenbergia cavernae DSM 12333 GCCGGTGCCGGTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4559780-4561120	Sequence	Bcav_4127 - ECF subfamily RNA polymerase sigma-24 subunit (Protein is coded in complementary strand; from 4561120 to 4559780)