Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4549292
End position: 4549315
Length: 24

DNA sequence
>NC_012669, from 4549292 to 4549315 (24 bp); Beutenbergia cavernae DSM 12333 CCGCCGGCGCCGCTGCCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4547732-4549975	Sequence	Bcav_4114 - hypothetical protein (Protein is coded in complementary strand; from 4549975 to 4547732)