Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4519620
End position: 4519643
Length: 24

DNA sequence
>NC_012669, from 4519620 to 4519643 (24 bp); Beutenbergia cavernae DSM 12333 AACAGCAACAGCAACAGCAACAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4518651-4520654	Sequence	Bcav_4088 - peptidase C14 caspase catalytic subunit p20